ptsG [2018-02-23 18:29:09]

trigger enzyme: major glucose permease of the PTS, EIICBA(Glc) and control of GlcT activity

locus: BSU13890

pI: 5.41

mw: 75.34 kDa

protein length: 699 aa

gene length: 2097 bp

function: glucose transport and phosphorylation, control of GlcT activity

product: trigger enzyme: glucose-specific enzyme IICBA component of the PTS

essential: no

ec: 2.7.1.69

synonyms: ptsX, crr

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
• [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]

Gene

Coordinates: 1,457,187 → 1,459,286

The protein

Catalyzed reaction/ biological activity

• transport and phosphorylation of glucose, receives a phosphate from [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] at the IIA domain (His-620), the phosphate group is then transferred to the IIB domain (Cys-461) an finally to the incoming glucose. In the absence of glucose, PtsG phosphorylates and thereby inactivates the transcriptional antiterminator [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT].

Protein family

• [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, glucose permease (Glc) family [Pubmed|10627040], [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] enzyme II

[SW|Domains]

• 11x transmembrane domain (16–36, 89–109, 139–159, 180–200, 233–253, 283–303, 313–333, 338–358, 365–385, 388–408)
• PTS EIIC domain ( 1-424)
• PTS EIIB domain (439–520)
• PTS EIIA domain (568–672)

Modification

• transient phosphorylation ([protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]-dependent) on His-620, then internal phosphotransfer from His-620 to Cys-461

Structure

• [PDB|1AX3] (IIA domain), [PDB|1GPR] (IIA domain), IIA domain [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=56258 NCBI], NMR IIA domain [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=55395 NCBI]

[SW|Localization]

• membrane protein [Pubmed|18763711]

Expression and Regulation

Operons

• genes: [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
  description: [Pubmed|11902727]

  sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]

  regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]

  regulation

  • expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]

Biological materials

Mutant

• BKE13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
• BKK13890 (Δ[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

Expression vector

• pGP123 (domains BA, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
• pGP141 (domains BA, mut: H620D, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
• pGP428 (EIIB, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
• pGP437(EIIA in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab

lacZ fusion

• pGP34 ([protein|search|pAC5]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
• pGP66 ([protein|search|pAC7]) [Pubmed|11902727], available in [SW|Jörg Stülke]'s lab
• pGP606 (mutant terminator, [protein|search|pAC6]), available in [SW|Jörg Stülke]'s lab
• pGP532 ([protein|search|pAC7]), available in [SW| Jörg Stülke]'s lab
• series of promoter deletions are available in [protein|search|pAC5] and [protein|search|pAC6], available in [SW|Jörg Stülke]'s lab
• series of RAT mutants are available in [protein|search|pAC6], available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

• [SW|Jörg Stülke], University of Göttingen, Germany
• [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

References

Reviews

• 18086213

Original publications

• 10627040,12850135,18763711,11902727,9765562,9513271,1956301,10543968,17074746,15155854,14527945,1508157,2120236,9593197,8418852,1581296,1316146,1733770,1942043,1911744,1906345,20081037,22846916,1447219